Skip to main content

pFastBacHT (His10-4xFRB-SNAP-Lck G2A)
(Plasmid #177887)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 177887 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFastBacHT
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Lck
  • Species
    H. sapiens (human)
  • Mutation
    G2A
  • Entrez Gene
    LCK (a.k.a. IMD22, LSK, YT16, p56lck, pp58lck)
  • Promoter Polyhedrin
  • Tag / Fusion Protein
    • 10xHis-TEV-4xFRB-SNAP tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer GGATTATTCATACCGTCCCA
  • 3′ sequencing primer CAAATGTGGTATGGCTGATT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFastBacHT (His10-4xFRB-SNAP-Lck G2A) was a gift from Ron Vale (Addgene plasmid # 177887 ; http://n2t.net/addgene:177887 ; RRID:Addgene_177887)
  • For your References section:

    In vitro membrane reconstitution of the T-cell receptor proximal signaling network. Hui E, Vale RD. Nat Struct Mol Biol. 2014 Feb;21(2):133-42. doi: 10.1038/nsmb.2762. Epub 2014 Jan 26. 10.1038/nsmb.2762 PubMed 24463463