pFastBac(His10-Shp2)
(Plasmid
#177899)
-
PurposeBaculo expression of His10 tag fused to human Shp2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177899 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFastBacHT
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameShp2
-
SpeciesH. sapiens (human)
-
Entrez GenePTPN11 (a.k.a. BPTP3, CFC, JMML, METCDS, NS1, PTP-1D, PTP2C, SH-PTP2, SH-PTP3, SHP2)
- Promoter Polyhedrin
-
Tag
/ Fusion Protein
- 10xHis-TEV-SNAP tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer GGATTATTCATACCGTCCCA
- 3′ sequencing primer CAAATGTGGTATGGCTGATT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFastBac(His10-Shp2) was a gift from Ron Vale (Addgene plasmid # 177899 ; http://n2t.net/addgene:177899 ; RRID:Addgene_177899) -
For your References section:
T cell costimulatory receptor CD28 is a primary target for PD-1-mediated inhibition. Hui E, Cheung J, Zhu J, Su X, Taylor MJ, Wallweber HA, Sasmal DK, Huang J, Kim JM, Mellman I, Vale RD. Science. 2017 Mar 31;355(6332):1428-1433. doi: 10.1126/science.aaf1292. Epub 2017 Mar 9. 10.1126/science.aaf1292 PubMed 28280247