pGEX6P2(GST-SNAP-Shp2tSH2)
(Plasmid
#177907)
-
PurposeBaculo expression of GST tag fused to SNAPtag and human Shp2 tandem SH2 domains
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177907 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGEX6P2
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameShp2 tandem SH2 domains (aa 6-218 only)
-
SpeciesH. sapiens (human)
-
Entrez GenePTPN11 (a.k.a. BPTP3, CFC, JMML, METCDS, NS1, PTP-1D, PTP2C, SH-PTP2, SH-PTP3, SHP2)
- Promoter tac
-
Tag
/ Fusion Protein
- GST-PreScission cut site-SNAP tag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGATTATTCATACCGTCCCA
- 3′ sequencing primer CAAATGTGGTATGGCTGATT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX6P2(GST-SNAP-Shp2tSH2) was a gift from Ron Vale (Addgene plasmid # 177907 ; http://n2t.net/addgene:177907 ; RRID:Addgene_177907) -
For your References section:
T cell costimulatory receptor CD28 is a primary target for PD-1-mediated inhibition. Hui E, Cheung J, Zhu J, Su X, Taylor MJ, Wallweber HA, Sasmal DK, Huang J, Kim JM, Mellman I, Vale RD. Science. 2017 Mar 31;355(6332):1428-1433. doi: 10.1126/science.aaf1292. Epub 2017 Mar 9. 10.1126/science.aaf1292 PubMed 28280247