p2B-56
(Plasmid
#177925)
-
PurposeExpresses optimized unleaky reverse tetracycline transactivator (rtTA-M2-SE-G72P) under control of yeast MYO2 promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 177925 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS426
- Backbone size w/o insert (bp) 5726
- Total vector size (bp) 7425
-
Vector typeBacterial Expression, Yeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameOptimized unleaky reverse tetracycline transactivator (rtTA-M2-SE-G72P) under control of yeast MYO2 promoter
-
Alt namepMYO2_rtTA-M2-SE-G72P
-
SpeciesS. cerevisiae (budding yeast); Bacteria
-
Insert Size (bp)1705
-
MutationV9I; F67S; G72P, F86Y; R171K
- Promoter MYO2
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGTAATACGACTCACTATAG
- 3′ sequencing primer CAATTAACCCTCACTAAAGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMads Kaern (University of Ottawa) kindly provided DNA sequences to design the inserts, as described in Roney et al. 2016 Sci Rep.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please refer to Roney et al. 2016 Sci Rep. "Improvement of the reverse tetracycline transactivator by single amino acid substitutions that reduce leaky target gene expression to undetectable levels" (doi: 10.1038/srep27697) for more information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p2B-56 was a gift from Vadim Gladyshev (Addgene plasmid # 177925 ; http://n2t.net/addgene:177925 ; RRID:Addgene_177925) -
For your References section:
Improved reverse tetracycline transactivator plasmids. Barre B, Gladyshev V. (unpublished) PubMed 27323850