pProUSER13F4C
(Plasmid
#178023)
-
PurposeE. coli - B. subtilis nicking vector pProUSER13F4C. Ap-BBR1; ΔsigF-insertion-site; Km; manR-PmanA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178023 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepProUSER13F4C
- Backbone size w/o insert (bp) 8169
- Total vector size (bp) 9961
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namenicking site to be replaced with your gene of interest
-
Insert Size (bp)1792
- Promoter Pman
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer aaggactatgcggttcatgc
- 3′ sequencing primer ccgagcgttctgaacaaatc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pProUSER13F4C was a gift from Sheila Jensen (Addgene plasmid # 178023 ; http://n2t.net/addgene:178023 ; RRID:Addgene_178023) -
For your References section:
The ProUSER2.0 Toolbox: Genetic Parts and Highly Customizable Plasmids for Synthetic Biology in Bacillus subtilis. Falkenberg KB, Mol V, de la Maza Larrea AS, Pogrebnyakov I, Norholm MHH, Nielsen AT, Jensen SI. ACS Synth Biol. 2021 Dec 17;10(12):3278-3289. doi: 10.1021/acssynbio.1c00130. Epub 2021 Nov 18. 10.1021/acssynbio.1c00130 PubMed 34793671