Skip to main content
Addgene

pProUSER13E3F
(Plasmid #178026)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178026 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pProUSER13E3F
  • Backbone size w/o insert (bp) 7067
  • Total vector size (bp) 8859
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Pir1
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    nicking site to be replaced with your gene of interest
  • Insert Size (bp)
    1792
  • Promoter Ptet

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer aagcagctctaatgcgctgt
  • 3′ sequencing primer ccgagcgttctgaacaaatc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pProUSER13E3F was a gift from Sheila Jensen (Addgene plasmid # 178026 ; http://n2t.net/addgene:178026 ; RRID:Addgene_178026)
  • For your References section:

    The ProUSER2.0 Toolbox: Genetic Parts and Highly Customizable Plasmids for Synthetic Biology in Bacillus subtilis. Falkenberg KB, Mol V, de la Maza Larrea AS, Pogrebnyakov I, Norholm MHH, Nielsen AT, Jensen SI. ACS Synth Biol. 2021 Dec 17;10(12):3278-3289. doi: 10.1021/acssynbio.1c00130. Epub 2021 Nov 18. 10.1021/acssynbio.1c00130 PubMed 34793671