pMSCV Cdk2ap1ΔN (MT2B2)-HA
(Plasmid
#178031)
-
PurposeRetroviral vector for the purpose of overexpression in mammalian cell culture
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178031 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMSCV PIG (Puro IRES GFP empty vector)
-
Backbone manufacturerDavid Bartel
- Backbone size w/o insert (bp) 7657
- Total vector size (bp) 7977
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCdk2ap1
-
Alt nameCdk2ap1 Chimeric
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)261
-
MutationFirst N-Terminal 27aa are deleted
-
GenBank ID13445
-
Entrez GeneCdk2ap1 (a.k.a. Apc10, Cdkap1, DORC1, Doc1, ST19, doc-1, p12)
- Promoter GAG
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XHO1 (not destroyed)
- 3′ cloning site EcoRi (not destroyed)
- 5′ sequencing primer cccttgaacctcctcgttcgacc
- 3′ sequencing primer gagacgtgctacttccatttgt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV Cdk2ap1ΔN (MT2B2)-HA was a gift from Lin He (Addgene plasmid # 178031 ; http://n2t.net/addgene:178031 ; RRID:Addgene_178031) -
For your References section:
A mouse-specific retrotransposon drives a conserved Cdk2ap1 isoform essential for development. Modzelewski AJ, Shao W, Chen J, Lee A, Qi X, Noon M, Tjokro K, Sales G, Biton A, Anand A, Speed TP, Xuan Z, Wang T, Risso D, He L. Cell. 2021 Oct 7. pii: S0092-8674(21)01104-1. doi: 10.1016/j.cell.2021.09.021. 10.1016/j.cell.2021.09.021 PubMed 34644528