Skip to main content

pMSCV Cdk2ap1ΔN (MT2B2)-HA
(Plasmid #178031)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178031 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMSCV PIG (Puro IRES GFP empty vector)
  • Backbone manufacturer
    David Bartel
  • Backbone size w/o insert (bp) 7657
  • Total vector size (bp) 7977
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cdk2ap1
  • Alt name
    Cdk2ap1 Chimeric
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    261
  • Mutation
    First N-Terminal 27aa are deleted
  • GenBank ID
    13445
  • Entrez Gene
    Cdk2ap1 (a.k.a. Apc10, Cdkap1, DORC1, Doc1, ST19, doc-1, p12)
  • Promoter GAG
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XHO1 (not destroyed)
  • 3′ cloning site EcoRi (not destroyed)
  • 5′ sequencing primer cccttgaacctcctcgttcgacc
  • 3′ sequencing primer gagacgtgctacttccatttgt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCV Cdk2ap1ΔN (MT2B2)-HA was a gift from Lin He (Addgene plasmid # 178031 ; http://n2t.net/addgene:178031 ; RRID:Addgene_178031)
  • For your References section:

    A mouse-specific retrotransposon drives a conserved Cdk2ap1 isoform essential for development. Modzelewski AJ, Shao W, Chen J, Lee A, Qi X, Noon M, Tjokro K, Sales G, Biton A, Anand A, Speed TP, Xuan Z, Wang T, Risso D, He L. Cell. 2021 Oct 7. pii: S0092-8674(21)01104-1. doi: 10.1016/j.cell.2021.09.021. 10.1016/j.cell.2021.09.021 PubMed 34644528