pET28a Cdk2ap1CAN-MutTER
(Plasmid
#178033)
-
PurposeExpression vector for the purpose of protein purification.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178033 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28a
-
Backbone manufacturerEMD Biosciences
- Backbone size w/o insert (bp) 5369
- Total vector size (bp) 6868
-
Vector typeBacterial Expression ; Nonviral
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCdk2ap1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1499
-
MutationChanged T(108)A, E(109)A, R(110)A
-
GenBank ID13445 13445
-
Entrez GeneCdk2ap1 (a.k.a. Apc10, Cdkap1, DORC1, Doc1, ST19, doc-1, p12)
- Promoter T7LacI
-
Tag
/ Fusion Protein
- 6xHIS - Thrombin - MBP- TEV-TRS (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NDE1 (not destroyed)
- 3′ cloning site XHOI (not destroyed)
- 5′ sequencing primer ggggaattgtgagcggataac
- 3′ sequencing primer gccaactcagcttcctttcg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a Cdk2ap1CAN-MutTER was a gift from Lin He (Addgene plasmid # 178033 ; http://n2t.net/addgene:178033 ; RRID:Addgene_178033) -
For your References section:
A mouse-specific retrotransposon drives a conserved Cdk2ap1 isoform essential for development. Modzelewski AJ, Shao W, Chen J, Lee A, Qi X, Noon M, Tjokro K, Sales G, Biton A, Anand A, Speed TP, Xuan Z, Wang T, Risso D, He L. Cell. 2021 Oct 7. pii: S0092-8674(21)01104-1. doi: 10.1016/j.cell.2021.09.021. 10.1016/j.cell.2021.09.021 PubMed 34644528