Skip to main content

pET28a Cdk2ap1CAN-MutTER
(Plasmid #178033)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178033 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28a
  • Backbone manufacturer
    EMD Biosciences
  • Backbone size w/o insert (bp) 5369
  • Total vector size (bp) 6868
  • Vector type
    Bacterial Expression ; Nonviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cdk2ap1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1499
  • Mutation
    Changed T(108)A, E(109)A, R(110)A
  • GenBank ID
    13445 13445
  • Entrez Gene
    Cdk2ap1 (a.k.a. Apc10, Cdkap1, DORC1, Doc1, ST19, doc-1, p12)
  • Promoter T7LacI
  • Tag / Fusion Protein
    • 6xHIS - Thrombin - MBP- TEV-TRS (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NDE1 (not destroyed)
  • 3′ cloning site XHOI (not destroyed)
  • 5′ sequencing primer ggggaattgtgagcggataac
  • 3′ sequencing primer gccaactcagcttcctttcg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a Cdk2ap1CAN-MutTER was a gift from Lin He (Addgene plasmid # 178033 ; http://n2t.net/addgene:178033 ; RRID:Addgene_178033)
  • For your References section:

    A mouse-specific retrotransposon drives a conserved Cdk2ap1 isoform essential for development. Modzelewski AJ, Shao W, Chen J, Lee A, Qi X, Noon M, Tjokro K, Sales G, Biton A, Anand A, Speed TP, Xuan Z, Wang T, Risso D, He L. Cell. 2021 Oct 7. pii: S0092-8674(21)01104-1. doi: 10.1016/j.cell.2021.09.021. 10.1016/j.cell.2021.09.021 PubMed 34644528