Skip to main content

ATP1A1_G3_MTOR_Nick_Intron-45_Dual_sgRNA
(Plasmid #178099)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178099 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Total vector size (bp) 3005
  • Vector type
    Mammalian Expression, CRISPR ; Prime editing

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATP1A1 G3 + MTOR nick intron-45 sgRNAs
  • gRNA/shRNA sequence
    GAGTTCTGTAATTCAGCATA and GGATCTTCAGGCTCCTGGCA
  • Species
    H. sapiens (human)
  • Promoter Tandem U6 promoters

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsrGI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CAGGGTTATTGTCTCATGAGCGG
  • 3′ sequencing primer TGAGCGAGGAAGCGGAAGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Control PE3 nick sgRNAs vector derived from ATP1A1_G3_Dual_sgRNA. This vector can be used as a positive control for prime editing (PE3) to co-target ATP1A1 (Q118R) and MTOR to perform coselection for MTOR rapamycin resistance mutation F2108L. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ATP1A1_G3_MTOR_Nick_Intron-45_Dual_sgRNA was a gift from Yannick Doyon (Addgene plasmid # 178099 ; http://n2t.net/addgene:178099 ; RRID:Addgene_178099)
  • For your References section:

    Marker-free co-selection for successive rounds of prime editing in human cells. Levesque S, Mayorga D, Fiset JP, Goupil C, Duringer A, Loiselle A, Bouchard E, Agudelo D, Doyon Y. Nat Commun. 2022 Oct 7;13(1):5909. doi: 10.1038/s41467-022-33669-z. 10.1038/s41467-022-33669-z PubMed 36207338