ATP1A1_G6_T804N_MTOR_I2017T_Dual_pegRNA
(Plasmid
#178108)
-
PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 T804N-G6 and MTOR-I2017T pegRNAs from two independent U6 promoters.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178108 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepU6-pegRNA-GG-acceptor
- Total vector size (bp) 2702
-
Vector typeMammalian Expression, CRISPR ; Prime editing
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATP1A1 G6 T804N pegRNA + MTOR-I2017T pegRNA
-
gRNA/shRNA sequenceGCAAACATTCCACTACCACT and GCATGCCAGAGGATGGCCACT
- Promoter Tandem U6 promoters
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer CAGGGTTATTGTCTCATGAGCGG
- 3′ sequencing primer GGGAAACGCCTGGTATCTTT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Control pegRNA vector derived from ATP1A1_G6_T804N_Dual_pegRNA. This vector can be used as a positive control for prime editing (PE3 in combination with ATP1A1_G8_MTOR_Nick_Exon-44_Dual_sgRNA) to co-target ATP1A1 (T804N) and MTOR to perform coselection for MTOR hyperactivating mutation I2017T. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ATP1A1_G6_T804N_MTOR_I2017T_Dual_pegRNA was a gift from Yannick Doyon (Addgene plasmid # 178108 ; http://n2t.net/addgene:178108 ; RRID:Addgene_178108) -
For your References section:
Marker-free co-selection for successive rounds of prime editing in human cells. Levesque S, Mayorga D, Fiset JP, Goupil C, Duringer A, Loiselle A, Bouchard E, Agudelo D, Doyon Y. Nat Commun. 2022 Oct 7;13(1):5909. doi: 10.1038/s41467-022-33669-z. 10.1038/s41467-022-33669-z PubMed 36207338