pXCX-sGFAP-DLDH-IRES-tdTomato
(Plasmid
#178311)
-
PurposeExpress the bacterial D-lactate dehydrogenase (DLDH) enzyme in astrocytes
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178311 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepXCX
- Backbone size w/o insert (bp) 11870
- Total vector size (bp) 12872
-
Vector typeMammalian Expression, Adenoviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameD-lactate dehydrogenase
-
Alt nameDLDH
-
SpeciesSynthetic
-
Insert Size (bp)1002
-
GenBank IDWP013438907
- Promoter sGFAP
-
Tag
/ Fusion Protein
- tdTomato (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer IREs forward (CCACTCATCTTATAGCTTTC)
- 3′ sequencing primer IRES reverse (CCAAGTCAGTGGCTGCAC)
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXCX-sGFAP-DLDH-IRES-tdTomato was a gift from Sergey Kasparov (Addgene plasmid # 178311 ; http://n2t.net/addgene:178311 ; RRID:Addgene_178311) -
For your References section:
Expression of Microbial Enzymes in Mammalian Astrocytes to Modulate Lactate Release. Vaccari Cardoso B, Barrera I, Mosienko V, Gourine AV, Kasparov S, Teschemacher AG. Brain Sci. 2021 Aug 10;11(8). pii: brainsci11081056. doi: 10.3390/brainsci11081056. 10.3390/brainsci11081056 PubMed 34439675