Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #1784)


Item Catalog # Description Quantity Price (USD)
Plasmid 1784 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 9439
  • Vector type
    Mammalian Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Alt name
    siRNA Twist
  • Alt name
  • Alt name
  • Species
    M. musculus (mouse)
  • GenBank ID
  • Entrez Gene
    Twist1 (a.k.a. M-Twi, M-Twist, Pde, Pluri, Ska, Ska10, Ska<m10J, Ska<m10Jus>, Twist, bHLHa, bHLHa38, pd, pdt)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstBI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer na
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Empty pSP108 vector can be obtained from Dr. Eric Fearson, Univ of Michigan
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid

Depositor Comments

Twist-siRNA3-targetting sequence is AAGCTGAGCAAGATTCAGACC

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Twist-siRNA3 was a gift from Bob Weinberg (Addgene plasmid # 1784 ; ; RRID:Addgene_1784)
  • For your References section:

    Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Yang J, Mani SA, Donaher JL, Ramaswamy S, Itzykson RA, Come C, Savagner P, Gitelman I, Richardson A, Weinberg RA. Cell 2004 Jun 25;117(7):927-39. 10.1016/j.cell.2004.06.006 PubMed 15210113