pCI-T7Max-UTR1-deGFP-8xHis-T500
(Plasmid
#178422)
-
PurposeExpression of deGFP via a T7 Promoter in TXTL
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178422 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePCI
- Backbone size w/o insert (bp) 2800
- Total vector size (bp) 3593
-
Modifications to backbonepromoter, RBS, MCS and terminator replaced. BsaI sites removed from the whole backbone.
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedeGFP
-
SpeciesSynthetic
-
Insert Size (bp)719
- Promoter T7Max
-
Tag
/ Fusion Protein
- 8xHis Tag (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer TTTTGCTCACATGGCTCG
- 3′ sequencing primer CCCCCTGAACCTGAAACATA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byVincent Noireaux Lab
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.10.17.464727v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCI-T7Max-UTR1-deGFP-8xHis-T500 was a gift from Kate Adamala (Addgene plasmid # 178422 ; http://n2t.net/addgene:178422 ; RRID:Addgene_178422) -
For your References section:
T7Max transcription system. Deich C, Cash B, Sato W, Sharon J, Aufdembrink L, Gaut NJ, Heili J, Stokes K, Engelhart AE, Adamala KP. J Biol Eng. 2023 Jan 23;17(1):4. doi: 10.1186/s13036-023-00323-1. 10.1186/s13036-023-00323-1 PubMed 36691081