Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pFUW-TetO-BATF
(Plasmid #178451)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 178451 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFUW-TetO
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BATF
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    378
  • GenBank ID
    NM_006399.3
  • Entrez Gene
    BATF (a.k.a. B-ATF, BATF1, SFA-2, SFA2)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (unknown if destroyed)
  • 3′ cloning site BstBI (unknown if destroyed)
  • 5′ sequencing primer TCCACGCTGTTTTGACCTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUW-TetO-BATF was a gift from Filipe Pereira (Addgene plasmid # 178451 ; http://n2t.net/addgene:178451 ; RRID:Addgene_178451)
  • For your References section:

    Single-cell transcriptional profiling informs efficient reprogramming of human somatic cells to cross-presenting dendritic cells. Rosa FF, Pires CF, Kurochkin I, Halitzki E, Zahan T, Arh N, Zimmermannova O, Ferreira AG, Li H, Karlsson S, Scheding S, Pereira CF. Sci Immunol. 2022 Mar 4;7(69):eabg5539. doi: 10.1126/sciimmunol.abg5539. Epub 2022 Mar 4. 10.1126/sciimmunol.abg5539 PubMed 35245086