Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pETM33_IRF3_SMAD/FHA
(Plasmid #178479)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 178479 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pETM33
  • Backbone size w/o insert (bp) 6017
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    IRF3_IRF3
  • Species
    H. sapiens (human); Synthetic
  • Entrez Gene
    IRF3 (a.k.a. IIAE7)
  • Promoter T7/LacO
  • Tag / Fusion Protein
    • His-GST (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nco1 (destroyed during cloning)
  • 3′ cloning site EcoR1 (destroyed during cloning)
  • 5′ sequencing primer CGGATCTGGAAGTTCTGTTCC
  • 3′ sequencing primer GAGTGCGGCCGCAAGCTTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2021.04.13.439572v1 for bioRxv preprint. Growth in BL21 DE3 gold 37 C after induction with 1mM IPTG 4 hours 30 C. Insert: mgSLDNPTPFPNLGPSENPLKRLLVPGEEWEFEVTAFYRGRQVFQQTISCPEGLRLVGSEVGDRTLPGWPVTLPDPGMSLTDRGVMSYVRHVLSCLGGGLALWRAGQWLWAQRLGHCHTYWAVSEELLPNSGHGPDGEVPKDKEGGVFDLGPFIVDLITFTEGSGRSPRYALWFCVGESWPQDQPWTKRLVMVKVVPTCLRALVEMARVGGASSLENTVDLHisNSHPLSLTSDQYKAYLQDLVEGMDFQGPGES.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pETM33_IRF3_SMAD/FHA was a gift from Ylva Ivarsson (Addgene plasmid # 178479 ; http://n2t.net/addgene:178479 ; RRID:Addgene_178479)
  • For your References section:

    Proteome-scale mapping of binding sites in the unstructured regions of the human proteome. Benz C, Ali M, Krystkowiak I, Simonetti L, Sayadi A, Mihalic F, Kliche J, Andersson E, Jemth P, Davey NE, Ivarsson Y. Mol Syst Biol. 2022 Jan;18(1):e10584. doi: 10.15252/msb.202110584. 10.15252/msb.202110584 PubMed 35044719