-
Purpose(Empty Backbone) Modifies pLX_317 backbone to express c-term HA tag (instead of c-term V5 tag)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178534 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLX_TRC317 (https://portals.broadinstitute.org/gpp/public/vector/details?vector=pLX_TRC317)
- Backbone size (bp) 8409
-
Modifications to backbonec-term HA on backbone instead of V5
-
Vector typeMammalian Expression
- Promoter EF1a
-
Selectable markersPuromycin
-
Tag
/ Fusion Protein
- HA (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Cloning Information
- 5′ sequencing primer EF1a-F (TCAAGCCTCAGACAGTGGTTC)
- 3′ sequencing primer WPRE-R (CATAGCGTAAAAGGAGCAACA)
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLX_HA was a gift from William Hahn (Addgene plasmid # 178534 ; http://n2t.net/addgene:178534 ; RRID:Addgene_178534) -
For your References section:
Sparse dictionary learning recovers pleiotropy from human cell fitness screens. Pan J, Kwon JJ, Talamas JA, Borah AA, Vazquez F, Boehm JS, Tsherniak A, Zitnik M, McFarland JM, Hahn WC. Cell Syst. 2022 Jan 21. pii: S2405-4712(21)00488-9. doi: 10.1016/j.cels.2021.12.005. 10.1016/j.cels.2021.12.005 PubMed 35085500