pLX_HA-C7orf26v2
(Plasmid
#178536)
-
PurposeSubcloned C7orf26v2 (ENST00000359073, Broad GPP TRCN0000477172) into pLX_HA backbone
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 178536 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLX_HA
- Backbone size w/o insert (bp) 8409
- Total vector size (bp) 8457
-
Modifications to backbonec-term HA on backbone
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameC7orf26v2
-
Alt nameENST00000359073
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1048
-
GenBank IDNM_001303039.2
-
Entrez GeneINTS15 (a.k.a. C7orf26)
- Promoter EF1a
-
Tag
/ Fusion Protein
- HA (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byC7orf26v2 from Broad (ENST00000359073, Broad GPP TRCN0000477172)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLX_HA-C7orf26v2 was a gift from William Hahn (Addgene plasmid # 178536 ; http://n2t.net/addgene:178536 ; RRID:Addgene_178536) -
For your References section:
Sparse dictionary learning recovers pleiotropy from human cell fitness screens. Pan J, Kwon JJ, Talamas JA, Borah AA, Vazquez F, Boehm JS, Tsherniak A, Zitnik M, McFarland JM, Hahn WC. Cell Syst. 2022 Jan 21. pii: S2405-4712(21)00488-9. doi: 10.1016/j.cels.2021.12.005. 10.1016/j.cels.2021.12.005 PubMed 35085500