Skip to main content

pLX_HA-C7orf26v2
(Plasmid #178536)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178536 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLX_HA
  • Backbone size w/o insert (bp) 8409
  • Total vector size (bp) 8457
  • Modifications to backbone
    c-term HA on backbone
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    C7orf26v2
  • Alt name
    ENST00000359073
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1048
  • GenBank ID
    NM_001303039.2
  • Entrez Gene
    INTS15 (a.k.a. C7orf26)
  • Promoter EF1a
  • Tag / Fusion Protein
    • HA (C terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    C7orf26v2 from Broad (ENST00000359073, Broad GPP TRCN0000477172)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLX_HA-C7orf26v2 was a gift from William Hahn (Addgene plasmid # 178536 ; http://n2t.net/addgene:178536 ; RRID:Addgene_178536)
  • For your References section:

    Sparse dictionary learning recovers pleiotropy from human cell fitness screens. Pan J, Kwon JJ, Talamas JA, Borah AA, Vazquez F, Boehm JS, Tsherniak A, Zitnik M, McFarland JM, Hahn WC. Cell Syst. 2022 Jan 21. pii: S2405-4712(21)00488-9. doi: 10.1016/j.cels.2021.12.005. 10.1016/j.cels.2021.12.005 PubMed 35085500