AAV-hGFAP-mCherry-shLuci
(Plasmid
#178588)
-
PurposeExpression of mCherry and a shRNA against luciferase under the human GFAP promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 178588 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemiRE-Luciferase
-
gRNA/shRNA sequenceTAGATAAGCATTATAATTCCTA
-
SpeciesOther
-
Insert Size (bp)1200
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-hGFAP-mCherry-shLuci was a gift from Chun-Li Zhang (Addgene plasmid # 178588 ; http://n2t.net/addgene:178588 ; RRID:Addgene_178588) -
For your References section:
Revisiting astrocyte to neuron conversion with lineage tracing in vivo. Wang LL, Serrano C, Zhong X, Ma S, Zou Y, Zhang CL. Cell. 2021 Oct 14;184(21):5465-5481.e16. doi: 10.1016/j.cell.2021.09.005. Epub 2021 Sep 27. 10.1016/j.cell.2021.09.005 PubMed 34582787