Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJAK175
(Plasmid #178601)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 178601 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAP259
  • Backbone manufacturer
    W. K. Smits, Leiden University Medical Center
  • Backbone size w/o insert (bp) 6914
  • Total vector size (bp) 8307
  • Modifications to backbone
    The Ptet promoter in pAP259 has been replaced with the C. difficile-derived xylose-inducible promoter.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Bitlucopt
  • Species
    Synthetic
  • Promoter Pxyl

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer CACCTCCTTTTTGACTTTAAGCCTACGAATACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please also cite:
Oliveira Paiva et al J Mol Biol. 2019 Jan 8. pii: S0022-2836(18)31160-4. doi: 10.1016/j.jmb.2019.01.001.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJAK175 was a gift from Robert Fagan (Addgene plasmid # 178601 ; http://n2t.net/addgene:178601 ; RRID:Addgene_178601)
  • For your References section:

    Potential Role of the Host-Derived Cell-Wall Binding Domain of Endolysin CD16/50L as a Molecular Anchor in Preservation of Uninfected Clostridioides difficile for New Rounds of Phage Infection. Phothichaisri W, Chankhamhaengdecha S, Janvilisri T, Nuadthaisong J, Phetruen T, Fagan RP, Chanarat S. Microbiol Spectr. 2022 Apr 4:e0236121. doi: 10.1128/spectrum.02361-21. 10.1128/spectrum.02361-21 PubMed 35377223