pAAV-mGrn-myc
(Plasmid
#178944)
-
PurposeConstruct for expressing murine progranulin (Grn) in AAV
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 178944 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneCIGW
- Backbone size w/o insert (bp) 6585
- Total vector size (bp) 8355
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGrn
-
Alt nameProgranulin
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1770
-
Entrez GeneGrn (a.k.a. GP88, PCDGF, PEPI, Pgrn, epithelin)
- Promoter CBA
-
Tag
/ Fusion Protein
- Myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TACGCCGGCGTTAATGCATATTCAGATCCTCTTCTGAG
- 3′ sequencing primer ATAGCGGCCGCTTAATGCATATTCAGATCCTCTTCTGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-mGrn-myc was a gift from Erik Roberson (Addgene plasmid # 178944 ; http://n2t.net/addgene:178944 ; RRID:Addgene_178944) -
For your References section:
Restoring neuronal progranulin reverses deficits in a mouse model of frontotemporal dementia. Arrant AE, Filiano AJ, Unger DE, Young AH, Roberson ED. Brain. 2017 May 1;140(5):1447-1465. doi: 10.1093/brain/awx060. 10.1093/brain/awx060 PubMed 28379303