Skip to main content
Addgene

pTU387
(Plasmid #178981)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178981 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pACYC Duet1
  • Backbone size w/o insert (bp) 3994
  • Total vector size (bp) 5367
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    CRISPR array from Candidatus Scalindua brodae
  • Species
    Candidatus Scalindua brodae
  • Insert Size (bp)
    1371
  • Promoter T7

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTATTGTACACGGCCGCATAATC
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains a single A nucleotide deletion in the CRISPR array from Candidatus Scalindua brodae. This deletion is in a non-coding region and does not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTU387 was a gift from Stan Brouns (Addgene plasmid # 178981 ; http://n2t.net/addgene:178981 ; RRID:Addgene_178981)
  • For your References section:

    The gRAMP CRISPR-Cas effector is an RNA endonuclease complexed with a caspase-like peptidase. van Beljouw SPB, Haagsma AC, Rodriguez-Molina A, van den Berg DF, Vink JNA, Brouns SJJ. Science. 2021 Sep 17;373(6561):1349-1353. doi: 10.1126/science.abk2718. Epub 2021 Aug 26. 10.1126/science.abk2718 PubMed 34446442