pTU425
(Plasmid
#178984)
-
PurposepACYC containing Candidatus “Scalindua brodae” TPR-CHAT H585A C627A (codon-optimized)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 178984 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepACYC Duet1
- Backbone size w/o insert (bp) 3695
- Total vector size (bp) 5855
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTPR-CHAT H585A C627A
-
SpeciesCandidatus Scalindua brodae
-
Insert Size (bp)2148
- Promoter T7
-
Tag
/ Fusion Protein
- His-tag (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACATCGTATAACGTTACTGG
- 3′ sequencing primer GAAGCAGTGTGACCGTGTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTU425 was a gift from Stan Brouns (Addgene plasmid # 178984 ; http://n2t.net/addgene:178984 ; RRID:Addgene_178984) -
For your References section:
The gRAMP CRISPR-Cas effector is an RNA endonuclease complexed with a caspase-like peptidase. van Beljouw SPB, Haagsma AC, Rodriguez-Molina A, van den Berg DF, Vink JNA, Brouns SJJ. Science. 2021 Sep 17;373(6561):1349-1353. doi: 10.1126/science.abk2718. Epub 2021 Aug 26. 10.1126/science.abk2718 PubMed 34446442