Skip to main content

pBBK13 pCAS-Tyr-[gRNA: 3=XII-2] (SplitKanR, AmpR)
(Plasmid #178997)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 178997 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    2-micron/pUC
  • Vector type
    Yeast Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    S. pyogenes Cas9
  • gRNA/shRNA sequence
    TCGAGAGAGTCGCCGATAGT
  • Species
    Streptococcus pyogenes

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Part of the Markerless Yeast Localization and Overexpression (MyLO) CRISPR-Cas9 Toolkit. Vector cloned using BsaI Golden Gate cloning

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBBK13 pCAS-Tyr-[gRNA: 3=XII-2] (SplitKanR, AmpR) was a gift from Vincent Martin (Addgene plasmid # 178997 ; http://n2t.net/addgene:178997 ; RRID:Addgene_178997)
  • For your References section:

    The MyLo CRISPR-Cas9 Toolkit: A Markerless Yeast Localization and Overexpression CRISPR-Cas9 Toolkit. Bean BDM, Whiteway M, Martin VJJ. G3 (Bethesda). 2022 Jun 16. pii: 6609175. doi: 10.1093/g3journal/jkac154. 10.1093/g3journal/jkac154 PubMed 35708612