pBBK22 pCAS-Tyr-[gRNA: 5=ARS308] (SplitHygR, AmpR)
(Plasmid
#179006)
-
PurposeSp.Cas9 and gRNA yeast expression vector with ARS308 gRNA pre-cloned. Selection =SplitHygromycin resistance
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179006 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbone2-micron/pUC
-
Vector typeYeast Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameS. pyogenes Cas9
-
gRNA/shRNA sequenceCACTTGTCAAACAGAATATA
-
SpeciesStreptococcus pyogenes
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Part of the Markerless Yeast Localization and Overexpression (MyLO) CRISPR-Cas9 Toolkit. Vector cloned using BsaI Golden Gate cloning
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBBK22 pCAS-Tyr-[gRNA: 5=ARS308] (SplitHygR, AmpR) was a gift from Vincent Martin (Addgene plasmid # 179006 ; http://n2t.net/addgene:179006 ; RRID:Addgene_179006) -
For your References section:
The MyLo CRISPR-Cas9 Toolkit: A Markerless Yeast Localization and Overexpression CRISPR-Cas9 Toolkit. Bean BDM, Whiteway M, Martin VJJ. G3 (Bethesda). 2022 Jun 16. pii: 6609175. doi: 10.1093/g3journal/jkac154. 10.1093/g3journal/jkac154 PubMed 35708612