Pzac2.1 U6-Fermt2 sgRNA1, 2, 3_gfaABC1D mcherry SV40
(Plasmid
#179117)
-
PurposeExpresses Fermt2 sgRNAs under the U6 promoter and mcherry protein specifically in astrocytes
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179117 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePZac2.1
-
Backbone manufacturerKhakh lab
- Backbone size w/o insert (bp) 5206
- Total vector size (bp) 6288
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFermt2 sgRNA
-
gRNA/shRNA sequence25, 26, 26
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer tgctctaggaagatc
- 3′ sequencing primer agctcacagagccagctcag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Pzac2.1 U6-Fermt2 sgRNA1, 2, 3_gfaABC1D mcherry SV40 was a gift from Baljit Khakh (Addgene plasmid # 179117 ; http://n2t.net/addgene:179117 ; RRID:Addgene_179117) -
For your References section:
Molecular basis of astrocyte diversity and morphology across the CNS in health and disease. Endo F, Kasai A, Soto JS, Yu X, Qu Z, Hashimoto H, Gradinaru V, Kawaguchi R, Khakh BS. Science. 2022 Nov 4;378(6619):eadc9020. doi: 10.1126/science.adc9020. Epub 2022 Nov 4. 10.1126/science.adc9020 PubMed 36378959