Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Pzac2.1 U6-Fermt2 sgRNA1, 2, 3_gfaABC1D mcherry SV40
(Plasmid #179117)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 179117 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PZac2.1
  • Backbone manufacturer
    Khakh lab
  • Backbone size w/o insert (bp) 5206
  • Total vector size (bp) 6288
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Fermt2 sgRNA
  • gRNA/shRNA sequence
    25, 26, 26
  • Species
    Synthetic
  • Promoter U6

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer tgctctaggaagatc
  • 3′ sequencing primer agctcacagagccagctcag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Pzac2.1 U6-Fermt2 sgRNA1, 2, 3_gfaABC1D mcherry SV40 was a gift from Baljit Khakh (Addgene plasmid # 179117 ; http://n2t.net/addgene:179117 ; RRID:Addgene_179117)
  • For your References section:

    Molecular basis of astrocyte diversity and morphology across the CNS in health and disease. Endo F, Kasai A, Soto JS, Yu X, Qu Z, Hashimoto H, Gradinaru V, Kawaguchi R, Khakh BS. Science. 2022 Nov 4;378(6619):eadc9020. doi: 10.1126/science.adc9020. Epub 2022 Nov 4. 10.1126/science.adc9020 PubMed 36378959