pCAG-mPpp3cc-FLAG-6XHIS
(Plasmid
#179160)
-
PurposeExpression vector of mouse protein phosphatase 3, catalytic subunit, gamma isoform (Ppp3cc) tagged with FLAG and 6X HIS at C-terminus, CAG promoter, rabbit globin poly(A) signal.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179160 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG1.1
- Backbone size w/o insert (bp) 5160
- Total vector size (bp) 6770
-
Modifications to backbonepCAGGS was used as an original vector.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameprotein phosphatase 3, catalytic subunit, gamma isoform
-
Alt namePpp3cc
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1610
-
Entrez GenePpp3cc (a.k.a. Calnc, PP2BA gamma)
-
Tags
/ Fusion Proteins
- FLAG (C terminal on insert)
- 6XHIS (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GCCTTCTTCTTTTTCCTACAGC
- 3′ sequencing primer GCCACACCAGCCACCACCTTCTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-mPpp3cc-FLAG-6XHIS was a gift from Masahito Ikawa (Addgene plasmid # 179160 ; http://n2t.net/addgene:179160 ; RRID:Addgene_179160) -
For your References section:
Sperm calcineurin inhibition prevents mouse fertility with implications for male contraceptive. Miyata H, Satouh Y, Mashiko D, Muto M, Nozawa K, Shiba K, Fujihara Y, Isotani A, Inaba K, Ikawa M. Science. 2015 Oct 23;350(6259):442-5. doi: 10.1126/science.aad0836. Epub 2015 Oct 1. 10.1126/science.aad0836 PubMed 26429887