Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCAG-hPPP3R2
(Plasmid #179163)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179163 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAG1.1
  • Backbone size w/o insert (bp) 5142
  • Total vector size (bp) 5670
  • Modifications to backbone
    pCAGGS was used as an original vector.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    protein phosphatase 3, regulatory subunit B, beta isoform
  • Alt name
    PPP3R2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    528
  • Entrez Gene
    PPP3R2 (a.k.a. PPP3RL)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GCCTTCTTCTTTTTCCTACAGC
  • 3′ sequencing primer GCCACACCAGCCACCACCTTCTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-hPPP3R2 was a gift from Masahito Ikawa (Addgene plasmid # 179163 ; http://n2t.net/addgene:179163 ; RRID:Addgene_179163)
  • For your References section:

    Sperm calcineurin inhibition prevents mouse fertility with implications for male contraceptive. Miyata H, Satouh Y, Mashiko D, Muto M, Nozawa K, Shiba K, Fujihara Y, Isotani A, Inaba K, Ikawa M. Science. 2015 Oct 23;350(6259):442-5. doi: 10.1126/science.aad0836. Epub 2015 Oct 1. 10.1126/science.aad0836 PubMed 26429887