pMini-Both
(Plasmid
#179258)
-
Purposeexpresses GFP CDS-derived linear and circular RNA transcript. Flanking introns contain NOVA2 binding sites
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179258 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2686
- Total vector size (bp) 4770
-
Modifications to backboneAdditional B-globin polyA sequence after bGH polyA sequence. Partial genomic region between CMV promoter and start of cassette insert removed.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namecircGFP
-
SpeciesSynthetic
-
Insert Size (bp)1459
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer caccaaaatcaacgggactt
- 3′ sequencing primer ATTTAGGTGACACTATAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMini-Both was a gift from Pedro Miura (Addgene plasmid # 179258 ; http://n2t.net/addgene:179258 ; RRID:Addgene_179258) -
For your References section:
NOVA2 regulates neural circRNA biogenesis. Knupp D, Cooper DA, Saito Y, Darnell RB, Miura P. Nucleic Acids Res. 2021 Jul 9;49(12):6849-6862. doi: 10.1093/nar/gkab523. 10.1093/nar/gkab523 PubMed 34157123