CcCDP_p15A
(Plasmid
#179272)
-
PurposeExpresses CcCDP in E. coli BL21(DE3)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179272 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneself assembled
- Backbone size w/o insert (bp) 3102
- Total vector size (bp) 6093
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsExpression in BL21(DE3), expression at room temperature (25°C)
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namecellodextrin phosphorylase
-
SpeciesClostridium cellulosi
-
Insert Size (bp)2991
-
GenBank IDCDZ24361.1 CDZ24361.1
- Promoter T7 lacO
-
Tag
/ Fusion Protein
- 6xHIS (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGACAACATCCTGGAAGCG
- 3′ sequencing primer GGGTGTCAACCATAATGCCG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CcCDP_p15A was a gift from Bernd Nidetzky (Addgene plasmid # 179272 ; http://n2t.net/addgene:179272 ; RRID:Addgene_179272) -
For your References section:
Engineering cascade biocatalysis in whole cells for bottom-up synthesis of cello-oligosaccharides: flux control over three enzymatic steps enables soluble production. Schwaiger KN, Voit A, Wiltschi B, Nidetzky B. Microb Cell Fact. 2022 Apr 9;21(1):61. doi: 10.1186/s12934-022-01781-w. 10.1186/s12934-022-01781-w PubMed 35397553