CcCDP_p15A
(Plasmid #179272)

• Purpose: Expresses CcCDP in E. coli BL21(DE3)
• Depositing Lab: Bernd Nidetzky
• Publication: Schwaiger et al Microb Cell Fact. 2022 Apr 9;21(1):61. doi: 10.1186/s12934-022-01781-w.

Backbone

• Vector backbone: self assembled
• Backbone size w/o insert (bp): 3102
• Total vector size (bp): 6093
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Expression in BL21(DE3), expression at room temperature (25°C)
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: cellodextrin phosphorylase
• Species: Clostridium cellulosi
• Insert Size (bp): 2991
• GenBank ID: CDZ24361.1 CDZ24361.1
• Promoter: T7 lacO
• Tag / Fusion Protein:
  • 6xHIS (N terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATGACAACATCCTGGAAGCG
• 3′ sequencing primer: GGGTGTCAACCATAATGCCG

Resource Information

• Supplemental Documents:
  • CcCDP_p15A.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry