pBICI_high ori
(Plasmid
#179273)
-
PurposeExpresses CuCBP and BaSP in E. coli BL21(DE3)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179273 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneself assembled
- Backbone size w/o insert (bp) 3344
- Total vector size (bp) 7388
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsUse E. coli BL21(DE3) for expression and grow at room temperature.
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameSucrose Phosphorylase from Bifidobacterium adolescentis
-
Alt nameBaSP
-
SpeciesBifidobacterium adolescentis
-
Insert Size (bp)1515
-
GenBank IDAF543301.1
-
Entrez GeneBAD_RS00415 (a.k.a. BAD_RS00415, BAD_0078)
- Promoter T7 lacO
-
Tag
/ Fusion Protein
- Strep - Tag II (N terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer aacccctcaagacccg
- 3′ sequencing primer CTGCGCGAAGAAGGCGTG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCellobiose phosphorylase from Cellulomonas uda
-
Alt nameCuCBP
-
SpeciesCellulomonas uda
-
Insert Size (bp)2466
-
GenBank IDAAQ20920.1
- Promoter T7 lacO
-
Tag
/ Fusion Protein
- His Tag (N terminal on backbone)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer taatacgactcactatagg
- 3′ sequencing primer CCAAAGTGACCCCGCGTAGCTGC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBICI_high ori was a gift from Bernd Nidetzky (Addgene plasmid # 179273 ; http://n2t.net/addgene:179273 ; RRID:Addgene_179273) -
For your References section:
Engineering cascade biocatalysis in whole cells for bottom-up synthesis of cello-oligosaccharides: flux control over three enzymatic steps enables soluble production. Schwaiger KN, Voit A, Wiltschi B, Nidetzky B. Microb Cell Fact. 2022 Apr 9;21(1):61. doi: 10.1186/s12934-022-01781-w. 10.1186/s12934-022-01781-w PubMed 35397553