pDUBI
(Plasmid
#179274)
-
PurposeExpresses CcCDP monocistronically and CuCBP and BaSP bicistronically
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179274 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneself assembled
- Backbone size w/o insert (bp) 3548
- Total vector size (bp) 10517
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsexpression at 25°C
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namecellodextrin phosphorylase
-
SpeciesClostridium cellulosi
-
Insert Size (bp)2991
-
GenBank IDCDZ24361.1 CDZ24361.1
- Promoter T7 lacO
-
Tag
/ Fusion Protein
- 6xHIS (N terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGACAACATCCTGGAAGCG
- 3′ sequencing primer CGGCATTATGGTTGACACCC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namecellobiose phosphorylase
-
SpeciesCellulomonas uda
-
Insert Size (bp)2463
-
GenBank IDAAQ20920.1
- Promoter T7 lacO
-
Tag
/ Fusion Protein
- 6xHIS (N terminal on backbone)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer taatacgactcactatagg
- 3′ sequencing primer CCAAAGTGACCCCGCGTAGCTGC
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameC8077_RS00435 sucrose phosphorylase [ Bifidobacterium adolescentis
-
SpeciesBifidobacterium alodescentis
-
Insert Size (bp)1515
-
Mutationsucrose phosphorylase
-
GenBank IDAF543301.1
-
Entrez GeneC8077_RS00435 (a.k.a. C8077_RS00435, C8077_00435)
- Promoter T7 lacO
-
Tag
/ Fusion Protein
- Strep-Tag II (N terminal on backbone)
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer aacccctcaagacccg
- 3′ sequencing primer CTGCGCGAAGAAGGCGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDUBI was a gift from Bernd Nidetzky (Addgene plasmid # 179274 ; http://n2t.net/addgene:179274 ; RRID:Addgene_179274) -
For your References section:
Engineering cascade biocatalysis in whole cells for bottom-up synthesis of cello-oligosaccharides: flux control over three enzymatic steps enables soluble production. Schwaiger KN, Voit A, Wiltschi B, Nidetzky B. Microb Cell Fact. 2022 Apr 9;21(1):61. doi: 10.1186/s12934-022-01781-w. 10.1186/s12934-022-01781-w PubMed 35397553