Skip to main content

pOUPc-Rh159-GFP
(Plasmid #179280)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179280 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pOUPc
  • Backbone manufacturer
    Steve Elledge lab made pInducer20 from which this was derived
  • Backbone size w/o insert (bp) 12092
  • Total vector size (bp) 13790
  • Modifications to backbone
    reverse tet transactivator 3G and TRE 3G
  • Vector type
    Mammalian Expression, Lentiviral ; all-in-one "tet" on lentiviral vector
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    can be grown 30-32 deg C
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rh159 fused to eGFP
  • Alt name
    Rh159
  • Species
    Macacine betaherpesvirus 3 (Rhesus cytomegalovirus)
  • Insert Size (bp)
    1698
  • GenBank ID
    NC_006150
  • Promoter Tet Responsive Element 3G
  • Tag / Fusion Protein
    • eGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer TCAGGTAGTGAACCGTCAG
  • 3′ sequencing primer TGATACTGGGGTTCTAAGGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOUPc-Rh159-GFP was a gift from Jeremy Kamil (Addgene plasmid # 179280 ; http://n2t.net/addgene:179280 ; RRID:Addgene_179280)
  • For your References section:

    The Human Cytomegalovirus Nonstructural Glycoprotein UL148 Reorganizes the Endoplasmic Reticulum. Zhang H, Read C, Nguyen CC, Siddiquey MNA, Shang C, Hall CM, von Einem J, Kamil JP. mBio. 2019 Dec 10;10(6). pii: mBio.02110-19. doi: 10.1128/mBio.02110-19. 10.1128/mBio.02110-19 PubMed 31822584