pOUPc-Rh159-GFP
(Plasmid
#179280)
-
PurposeAll in one "tet-on" lentivirus vector that expresses rhesus cytomegalovirus Rh159 fused to an eGFP tag at its cytoplasmic tail. Rh159 is an ER resident protein that binds NKG2D activating ligands.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179280 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepOUPc
-
Backbone manufacturerSteve Elledge lab made pInducer20 from which this was derived
- Backbone size w/o insert (bp) 12092
- Total vector size (bp) 13790
-
Modifications to backbonereverse tet transactivator 3G and TRE 3G
-
Vector typeMammalian Expression, Lentiviral ; all-in-one "tet" on lentiviral vector
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionscan be grown 30-32 deg C
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRh159 fused to eGFP
-
Alt nameRh159
-
SpeciesMacacine betaherpesvirus 3 (Rhesus cytomegalovirus)
-
Insert Size (bp)1698
-
GenBank IDNC_006150
- Promoter Tet Responsive Element 3G
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer TCAGGTAGTGAACCGTCAG
- 3′ sequencing primer TGATACTGGGGTTCTAAGGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOUPc-Rh159-GFP was a gift from Jeremy Kamil (Addgene plasmid # 179280 ; http://n2t.net/addgene:179280 ; RRID:Addgene_179280) -
For your References section:
The Human Cytomegalovirus Nonstructural Glycoprotein UL148 Reorganizes the Endoplasmic Reticulum. Zhang H, Read C, Nguyen CC, Siddiquey MNA, Shang C, Hall CM, von Einem J, Kamil JP. mBio. 2019 Dec 10;10(6). pii: mBio.02110-19. doi: 10.1128/mBio.02110-19. 10.1128/mBio.02110-19 PubMed 31822584