pHsSyx3-MBP
(Plasmid
#179286)
-
PurposeE. coli expression plasmid (T7 promoter) for expression-optimized DNA of human Syx (aa 393-792) with C-terminal TEV protease cleavage site + mature maltose binding protein + His6
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179286 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET MBP His6 LIC (2Cc-T), Addgene # 37237
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 5900
- Total vector size (bp) 7102
-
Modifications to backbonenone
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSyx
-
Alt namesynectin-binding guanine exchange factor
-
Alt namepleckstrin homology domain-containing family G member 5 isoform c
-
Alt namePLEKHG5; CMTRIC; DSMA4; GEF720; Tech
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1200
-
Mutationresidues 393-792 from accession number NP_001036128.1; optimized DNA sequence
-
GenBank IDNP_001036128.1
- Promoter T7
-
Tag
/ Fusion Protein
- TEV protease cleavage site + mature maltose binding protein + His6 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (destroyed during cloning)
- 3′ cloning site HpaI (destroyed during cloning)
- 5′ sequencing primer T7, TAATACGACTCACTATAGGG
- 3′ sequencing primer 37237 seq R, GTGACTTTAATTCCGGTATCTTTCTCG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe insert had been ordered from GenScript as an E. coli expression-optimized synthetic DNA.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Protein sequence is Met + human Syx (synectin-binding guanine exchange factor; aa 393-792 from accession number NP_001036128.1) + TEV protease cleavage (ENLYFQ*S; * = cleavage site) + GSSGSM + maltose binding protein (aa 27-393 of AAB59056) + GSS + HHHHHH.
Confers ampicillin-resistance.
Backbone vector is pET MBP His6 LIC (2Cc-T) Addgene # 37237.
Construct design by Ryan Boyd and Debra T. Hansen.
Cloning by Felicia M. Craciunescu.
Preprint: Boyd et al., bioRxiv 2021.08.26.457821, https://doi.org/10.1101/2021.08.26.457821
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHsSyx3-MBP was a gift from Debra Hansen (Addgene plasmid # 179286 ; http://n2t.net/addgene:179286 ; RRID:Addgene_179286) -
For your References section:
Characterization and computational simulation of human Syx, a RhoGEF implicated in glioblastoma. Boyd RJ, Olson TL, Zook JD, Stein D, Aceves M, Lin WH, Craciunescu FM, Hansen DT, Anastasiadis PZ, Singharoy A, Fromme P. FASEB J. 2022 Jul;36(7):e22378. doi: 10.1096/fj.202101808RR. 10.1096/fj.202101808RR PubMed 35639414