Skip to main content
Addgene

HIS_TEV_hsSYX3
(Plasmid #179290)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179290 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET-28a
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5236
  • Total vector size (bp) 6499
  • Modifications to backbone
    none
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Syx
  • Alt name
    synectin-binding guanine exchange factor
  • Alt name
    pleckstrin homology domain-containing family G member 5 isoform c
  • Alt name
    PLEKHG5; CMTRIC; DSMA4; GEF720; Tech
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1200
  • Mutation
    residues 393-792 from accession number NP_001036128.1; optimized DNA sequence
  • GenBank ID
    NP_001036128.1
  • Promoter T7lac
  • Tag / Fusion Protein
    • His6 + TEV protease cleavage site (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer T7, TAATACGACTCACTATAGGG
  • 3′ sequencing primer T7 Terminal, GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The insert had been ordered from GenScript as an E. coli expression-optimized synthetic DNA.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Protein sequence is MGSS + HHHHHH + GGG + TEV protease cleavage (ENLYFQ*S; * = cleavage site) + human Syx (synectin-binding guanine exchange factor; aa 393-792 from accession number NP_001036128.1).
Confers kanamycin-resistance.
Backbone vector is pET-28a.
Construct design by Ryan Boyd.
Preprint: Boyd et al., bioRxiv 2021.08.26.457821, https://doi.org/10.1101/2021.08.26.457821

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HIS_TEV_hsSYX3 was a gift from Debra Hansen (Addgene plasmid # 179290 ; http://n2t.net/addgene:179290 ; RRID:Addgene_179290)
  • For your References section:

    Characterization and computational simulation of human Syx, a RhoGEF implicated in glioblastoma. Boyd RJ, Olson TL, Zook JD, Stein D, Aceves M, Lin WH, Craciunescu FM, Hansen DT, Anastasiadis PZ, Singharoy A, Fromme P. FASEB J. 2022 Jul;36(7):e22378. doi: 10.1096/fj.202101808RR. 10.1096/fj.202101808RR PubMed 35639414