pMBP-HsSyx-375-792
(Plasmid #179291)

• Purpose: E. coli expression plasmid (T7 promoter) for expression-optimized DNA of human Syx (aa 375-792) with N-terminal His6 + mature maltose binding protein + TEV protease cleavage site
• Depositing Lab: Debra Hansen
• Publication: Boyd et al FASEB J. 2022 Jul;36(7):e22378. doi: 10.1096/fj.202101808RR.

Backbone

• Vector backbone: pET His6 MBP TEV LIC (2M-T) Addgene # 2970
• Backbone manufacturer: Addgene
• Backbone size w/o insert (bp): 5913
• Total vector size (bp): 7167
• Modifications to backbone: none
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Syx
• Alt name: synectin-binding guanine exchange factor
• Alt name: pleckstrin homology domain-containing family G member 5 isoform c
• Alt name: PLEKHG5; CMTRIC; DSMA4; GEF720; Tech
• Species: H. sapiens (human)
• Insert Size (bp): 1254
• Mutation: residues 375-792 from accession number NP_001036128.1; optimized DNA sequence
• GenBank ID: NP_001036128.1
• Promoter: T7
• Tag / Fusion Protein:
  • His6 + mature maltose binding protein + TEV protease cleavage site (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SspI (destroyed during cloning)
• 3′ cloning site: SspI (destroyed during cloning)
• 5′ sequencing primer: MBPFOR, GATGTCCGCTTTCTGGTATGC
• 3′ sequencing primer: T7 Terminal, GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pMBP-HsSyx-375-792.gb
• A portion of this plasmid was derived from a plasmid made by: The insert had been ordered from GenScript as an E. coli expression-optimized synthetic DNA.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Protein sequence is MKSS + HHHHHH + GSS + maltose binding protein (aa 27-393 of AAB59056) + NGIE + TEV protease cleavage (ENLYFQ*S; * = cleavage site) + N + human Syx (synectin-binding guanine exchange factor; aa 375-792 from accession number NP_001036128.1; DNA for residues 375-392 was generated by oligonucleotides using optimal codons).
Confers ampicillin-resistance.
Backbone vector is pET His6 MBP TEV LIC (2M-T) Addgene # 29708.
This plasmid is mentioned in Fig. S3 of the 2021 bioRxiv paper.
Construct design by Ryan Boyd and Debra T. Hansen.
Cloning by Felicia M. Craciunescu.
Preprint: Boyd et al., bioRxiv 2021.08.26.457821, https://doi.org/10.1101/2021.08.26.457821