pGST-HsSyx-375-792
(Plasmid
#179292)
-
PurposeE. coli expression plasmid (T7 promoter) for expression-optimized DNA of human Syx (aa 375-792) with N-terminal His6 + GST + TEV protease cleavage site
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179292 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET His6 GST TEV LIC (2G-T) Addgene # 29707
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 5463
- Total vector size (bp) 6717
-
Modifications to backbonenone
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSyx
-
Alt namesynectin-binding guanine exchange factor
-
Alt namepleckstrin homology domain-containing family G member 5 isoform c
-
Alt namePLEKHG5; CMTRIC; DSMA4; GEF720; Tech
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1254
-
Mutationresidues 375-792 from accession number NP_001036128.1; optimized DNA sequence
-
GenBank IDNP_001036128.1
- Promoter T7
-
Tag
/ Fusion Protein
- His6 + GST + TEV protease cleavage site (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SspI (destroyed during cloning)
- 3′ cloning site SspI (destroyed during cloning)
- 5′ sequencing primer pGEX 5', GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer T7 Terminal, GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe insert had been ordered from GenScript as an E. coli expression-optimized synthetic DNA.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Protein sequence is MKSS + HHHHHH + GSS + GST (glutathione S-transferase; aa 1-218 of WP_008430144.1) + GIE + TEV protease cleavage (ENLYFQ*S; * = cleavage site) + N + human Syx (synectin-binding guanine exchange factor; aa 375-792 from accession number NP_001036128.1; DNA for residues 375-392 was generated by oligonucleotides using optimal codons).
Confers ampicillin-resistance.
Backbone vector is pET His6 GST TEV LIC (2G-T) Addgene # 29707.
Construct design by Ryan Boyd and Debra T. Hansen.
Cloning by Felicia M. Craciunescu.
Preprint: Boyd et al., bioRxiv 2021.08.26.457821, https://doi.org/10.1101/2021.08.26.457821
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGST-HsSyx-375-792 was a gift from Debra Hansen (Addgene plasmid # 179292 ; http://n2t.net/addgene:179292 ; RRID:Addgene_179292) -
For your References section:
Characterization and computational simulation of human Syx, a RhoGEF implicated in glioblastoma. Boyd RJ, Olson TL, Zook JD, Stein D, Aceves M, Lin WH, Craciunescu FM, Hansen DT, Anastasiadis PZ, Singharoy A, Fromme P. FASEB J. 2022 Jul;36(7):e22378. doi: 10.1096/fj.202101808RR. 10.1096/fj.202101808RR PubMed 35639414