Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pOUPc-Rh159-HA
(Plasmid #179344)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179344 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pOUPc (modified pInducer20)
  • Backbone manufacturer
    Steve Elledge
  • Backbone size w/o insert (bp) 12096
  • Total vector size (bp) 13101
  • Vector type
    Mammalian Expression, Lentiviral ; all in one tet-on lentiviral vector (HIV-1 based, replication defective)
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rh159
  • Alt name
    Rhesus CMV Rh159
  • Species
    Macacine betaherpesvirus 3 (Rhesus cytomegalovirus)
  • Insert Size (bp)
    1005
  • GenBank ID
    NC_006150.1
  • Promoter tet responsive element 3G
  • Tag / Fusion Protein
    • HA tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCAGGTAGTGAACCGTCAG
  • 3′ sequencing primer TGATACTGGGGTTCTAAGGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOUPc-Rh159-HA was a gift from Jeremy Kamil (Addgene plasmid # 179344 ; http://n2t.net/addgene:179344 ; RRID:Addgene_179344)
  • For your References section:

    The Human Cytomegalovirus Endoplasmic Reticulum-Resident Glycoprotein UL148 Activates the Unfolded Protein Response. Siddiquey MNA, Zhang H, Nguyen CC, Domma AJ, Kamil JP. J Virol. 2018 Sep 26;92(20). pii: JVI.00896-18. doi: 10.1128/JVI.00896-18. Print 2018 Oct 15. 10.1128/JVI.00896-18 PubMed 30045994