ePB-PURO-TT-PA-CRE
(Plasmid
#179584)
-
PurposeePiggyBac vector to conditionally express using DOX a light-inducible Cre-recombinase enzyme that takes advantage of the Magnets dimerization system (Magnet-CRE)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179584 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneKS(-)
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePA-MAG-CRE
- Promoter TRE
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer CGTATGTCGAGTTTACTCCC
- 3′ sequencing primer gttaacaacaacaattgcattc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ePB-PURO-TT-PA-CRE was a gift from Ali Hemmati Brivanlou (Addgene plasmid # 179584 ; http://n2t.net/addgene:179584 ; RRID:Addgene_179584) -
For your References section:
Self-organization of human dorsal-ventral forebrain structures by light induced SHH. De Santis R, Etoc F, Rosado-Olivieri EA, Brivanlou AH. Nat Commun. 2021 Nov 19;12(1):6768. doi: 10.1038/s41467-021-26881-w. 10.1038/s41467-021-26881-w PubMed 34799555