Skip to main content

pJH2028
(Plasmid #179771)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 179771 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pBSK
  • Backbone manufacturer
    stratagene
  • Backbone size w/o insert (bp) 5089
  • Total vector size (bp) 10406
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NLF-1::2XGFP
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    5317
  • GenBank ID
  • Entrez Gene
    nlf-1 (a.k.a. CELE_F55A4.2)
  • Promoter nlf-1
  • Tag / Fusion Protein
    • 2XGFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer ATGCGGCCTCGCACGCCTTA
  • 3′ sequencing primer CTATAACAACAACATA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note Addgene NGS found some differences in genomic sequence of NLF-1. Depositor confirms this does not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJH2028 was a gift from Mei Zhen (Addgene plasmid # 179771 ; http://n2t.net/addgene:179771 ; RRID:Addgene_179771)
  • For your References section:

    NLF-1 delivers a sodium leak channel to regulate neuronal excitability and modulate rhythmic locomotion. Xie L, Gao S, Alcaire SM, Aoyagi K, Wang Y, Griffin JK, Stagljar I, Nagamatsu S, Zhen M. Neuron. 2013 Mar 20;77(6):1069-82. doi: 10.1016/j.neuron.2013.01.018. 10.1016/j.neuron.2013.01.018 PubMed 23522043