pCOA-Leu-FvPPT1-fsr1
(Plasmid
#179868)
-
PurposeConstitutive expression vector for Saccharomyces cerevisiae comprising the polyketide synthase fsr1 from Fusarium vanettenii and the Fusarium verticillioides 4´-phosphopantetheinyltransferase PPT1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179868 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepESC-LEU
-
Backbone manufacturerAgilent Technologies
- Backbone size w/o insert (bp) 8660
- Total vector size (bp) 16436
-
Modifications to backboneAdded broad host-range origin of replication ARS68 from Yarrowia lipolytica. Subtituted GAL1/10 bidirectional promoter for Yarrowia lipolytica EXP1 and TEF-1α.
-
Vector typeYeast Expression
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namePPT1
-
Alt nameFvPPT1
-
Alt namePPTase
-
SpeciesFusarium verticillioides
-
Insert Size (bp)879
-
MutationCodon optimized for expression in Saccharomyces cerevisiae
-
GenBank IDFVEG_01894 XP_018744954
- Promoter Yarrowia lipolytica EXP1
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CCCGGATCCGTAATACGACT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namefsr1
-
Alt namePKS3
-
SpeciesFusarium vanettenii 77-13-4
-
Insert Size (bp)6897
-
MutationCodon optimized for expression in Saccharomyces cerevisiae
-
GenBank IDNECHADRAFT_101778 XP_003039929
- Promoter Yarrowia lipolytica TEF-1α
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AGCTGAATTGGAGCGACCTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCOA-Leu-FvPPT1-fsr1 was a gift from Jens Laurids Sørensen (Addgene plasmid # 179868 ; http://n2t.net/addgene:179868 ; RRID:Addgene_179868) -
For your References section:
Yeast recombinational cloning for heterologous biosynthesis of polyketides: a molecular microbiology laboratory module for undergraduate students. Bejenari M, Nielsen L, Spedtsberg EML, Nielsen MR, Pedersen TB, Sorensen JL. J Microbiol Biol Educ. 2023 Nov 27;24(3):e00242-22. doi: 10.1128/jmbe.00242-22. eCollection 2023 Dec. 10.1128/jmbe.00242-22 PubMed 38108002