pClgn-Lrrc23-FLAG
(Plasmid
#179921)
-
PurposeVector backbone. pClgn-promoter driven expression.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179921 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepClgn-FLAG
- Backbone size w/o insert (bp) 3788
- Total vector size (bp) 4808
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLrrc23
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1020
-
MutationStop codon removed
-
GenBank IDNM_001302555.1 NM_001302555.1
-
Entrez GeneLrrc23 (a.k.a. 4921537K05Rik, B7, Lrpb7)
- Promoter Calmegin
-
Tag
/ Fusion Protein
- FLAG (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site EcoRV (not destroyed)
- 5′ sequencing primer TTGAGCGGGCCGCTTGCGCACTGG
- 3′ sequencing primer GCCACACCAGCCACCACCTTCTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pClgn-Lrrc23-FLAG was a gift from Masahito Ikawa (Addgene plasmid # 179921 ; http://n2t.net/addgene:179921 ; RRID:Addgene_179921) -
For your References section:
LRRC23 is a conserved component of the radial spoke that is necessary for sperm motility and male fertility in mice. Zhang X, Sun J, Lu Y, Zhang J, Shimada K, Noda T, Zhao S, Koyano T, Matsuyama M, Zhou S, Wu J, Ikawa M, Liu M. J Cell Sci. 2021 Oct 15;134(20). pii: 272563. doi: 10.1242/jcs.259381. Epub 2021 Oct 21. 10.1242/jcs.259381 PubMed 34585727