pJV457
(Plasmid
#180080)
-
PurposeM.BbrUI expression construct to improve transformation in B. breve UCC2003
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 180080 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJV170
- Backbone size w/o insert (bp) 3202
-
Modifications to backbone3672
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)KL740
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameM.BbrUI
-
SpeciesBifidobacterium breve
- Promoter P70a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAAAACGACCTTTCTGTGGT
- 3′ sequencing primer GTCCTACGAGTTGCATGATA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJV457 was a gift from Chase Beisel (Addgene plasmid # 180080 ; http://n2t.net/addgene:180080 ; RRID:Addgene_180080) -
For your References section:
A cell-free transcription-translation pipeline for recreating methylation patterns boosts DNA transformation in bacteria. Vento JM, Durmusoglu D, Li T, Patinios C, Sullivan S, Ttofali F, van Schaik J, Yu Y, Wang Y, Barquist L, Crook N, Beisel CL. Mol Cell. 2024 Jul 25;84(14):2785-2796.e4. doi: 10.1016/j.molcel.2024.06.003. Epub 2024 Jun 26. 10.1016/j.molcel.2024.06.003 PubMed 38936361