Skip to main content

pJV461
(Plasmid #180081)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180081 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJV170
  • Backbone size w/o insert (bp) 3202
  • Modifications to backbone
    3671
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    KL740
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    M.BbrUIII
  • Species
    Bifidobacterium breve
  • Promoter P70a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAAAACGACCTTTCTGTGGT
  • 3′ sequencing primer GTCCTACGAGTTGCATGATA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJV461 was a gift from Chase Beisel (Addgene plasmid # 180081 ; http://n2t.net/addgene:180081 ; RRID:Addgene_180081)
  • For your References section:

    A cell-free transcription-translation pipeline for recreating methylation patterns boosts DNA transformation in bacteria. Vento JM, Durmusoglu D, Li T, Patinios C, Sullivan S, Ttofali F, van Schaik J, Yu Y, Wang Y, Barquist L, Crook N, Beisel CL. Mol Cell. 2024 Jul 25;84(14):2785-2796.e4. doi: 10.1016/j.molcel.2024.06.003. Epub 2024 Jun 26. 10.1016/j.molcel.2024.06.003 PubMed 38936361