pWZL Hygro- TRF2 deltaM
(Plasmid
#18012)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 18012 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepWZL Hygro
- Backbone size w/o insert (bp) 5900
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehTRF2
-
Alt namehuman TTAGGG repeat binding factor 2
-
Alt name2457
-
Alt nameTERF2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1368
-
MutationDeleted Myb Domain (aa454-500)
-
Entrez GeneTERF2 (a.k.a. TRBF2, TRF2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CCTTTGTACACCCTAAGCCT
- 3′ sequencing primer AATGCTCGTCAAGAAGAC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWZL Hygro- TRF2 deltaM was a gift from Titia de Lange (Addgene plasmid # 18012 ; http://n2t.net/addgene:18012 ; RRID:Addgene_18012) -
For your References section:
Senescence induced by altered telomere state, not telomere loss. Karlseder J, Smogorzewska A, de Lange T. Science. 2002 Mar 29. 295(5564):2446-9. 10.1126/science.1069523 PubMed 11923537
Map uploaded by the depositor.