Skip to main content

pWZL Hygro- TRF2 deltaM
(Plasmid #18012)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 18012 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pWZL Hygro
  • Backbone size w/o insert (bp) 5900
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hTRF2
  • Alt name
    human TTAGGG repeat binding factor 2
  • Alt name
    2457
  • Alt name
    TERF2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1368
  • Mutation
    Deleted Myb Domain (aa454-500)
  • Entrez Gene
    TERF2 (a.k.a. TRBF2, TRF2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CCTTTGTACACCCTAAGCCT
  • 3′ sequencing primer AATGCTCGTCAAGAAGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWZL Hygro- TRF2 deltaM was a gift from Titia de Lange (Addgene plasmid # 18012 ; http://n2t.net/addgene:18012 ; RRID:Addgene_18012)
  • For your References section:

    Senescence induced by altered telomere state, not telomere loss. Karlseder J, Smogorzewska A, de Lange T. Science. 2002 Mar 29. 295(5564):2446-9. 10.1126/science.1069523 PubMed 11923537