pRB144
(Plasmid
#180175)
-
PurposepCDNA3.1 Construct GluN1 A714L
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 180175 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDNA3.1
-
Backbone manufacturerAddgene #82612
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGluN1
-
Alt nameGriN1/ NMDAR1
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)3549
-
MutationA714L
-
Entrez GeneGrin1 (a.k.a. GluN1, NMDAR1, NR1)
-
Tag
/ Fusion Protein
- Phluorin (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BamH1 (not destroyed)
- 5′ sequencing primer GluN1 SeqF1 CATGGTGTGGGCTGGTTTCG
- 3′ sequencing primer GluN1 SeqR1 TGCAGGTTCTTCCTCCACAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRB144 was a gift from Richard Bergeron (Addgene plasmid # 180175 ; http://n2t.net/addgene:180175 ; RRID:Addgene_180175) -
For your References section:
Glycine-induced NMDA receptor internalization provides neuroprotection and preserves vasculature following ischemic stroke. Cappelli J, Khacho P, Wang B, Sokolovski A, Bakkar W, Raymond S, Ahlskog N, Pitney J, Wu J, Chudalayandi P, Wong AYC, Bergeron R. iScience. 2021 Dec 3;25(1):103539. doi: 10.1016/j.isci.2021.103539. eCollection 2022 Jan 21. 10.1016/j.isci.2021.103539 PubMed 34977503