-
PurposeReporter plasmid utilizing d2eGFP as a reporter gene. Expression is designed to mimick IFNB1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 180232 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCCL/PGK-eGFP
-
Backbone manufacturerPMID: 9765382
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert named2eGFP
-
Alt nameDestabilized eGFP
-
Insert Size (bp)846
- Promoter 1 kb upstream of IFNB1 CDS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACGGATCTCGACGGTATCGG
- 3′ sequencing primer ATAGCATGATACAAAGGCAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCCL/IFNB1-d2eGFP-3’UTR was a gift from Jacob Giehm Mikkelsen (Addgene plasmid # 180232 ; http://n2t.net/addgene:180232 ; RRID:Addgene_180232) -
For your References section:
Single-Cell Monitoring of Activated Innate Immune Signaling by a d2eGFP-Based Reporter Mimicking Time-Restricted Activation of IFNB1 Expression. Thomsen EA, Andersen S, Marqvorsen MHS, Skipper KA, Paludan SR, Mikkelsen JG. Front Cell Infect Microbiol. 2022 Jan 18;11:784762. doi: 10.3389/fcimb.2021.784762. eCollection 2021. 10.3389/fcimb.2021.784762 PubMed 35118008