Skip to main content
Addgene

Pb mD3S4-dN
(Plasmid #180252)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180252 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pD2529CAG
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    D3 of P. berghei HAP2 with N-glycosylation sites mutated
  • Species
    P. berghei
  • Mutation
    N516T, S533N and N539Q
  • Tag / Fusion Protein
    • 6His (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTTCCTACAGCTCCTGGGCAA
  • 3′ sequencing primer TGCCACAGATGTTACTTAGCCTTT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Pb mD3S4-dN was a gift from Timothy Springer (Addgene plasmid # 180252 ; http://n2t.net/addgene:180252 ; RRID:Addgene_180252)
  • For your References section:

    Structural basis of malaria transmission blockade by a monoclonal antibody to gamete fusogen HAP2. Feng J, Dong X, DeCosta A, Su Y, Angrisano F, Sala KA, Blagborough AM, Lu C, Springer TA. Elife. 2021 Dec 23;10. pii: 74707. doi: 10.7554/eLife.74707. 10.7554/eLife.74707 PubMed 34939934