Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pD2529-CAG-Flag-mouse TGFb3
(Plasmid #180262)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 180262 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TGFβ3
  • Alt name
    TGFb3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1167
  • Entrez Gene
    Tgfb3 (a.k.a. TGF-beta-3, Tgfb-3)
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTTCCTACAGCTCCTGGGCAA
  • 3′ sequencing primer TGCCACAGATGTTACTTAGCCTTT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pD2529-CAG-Flag-mouse TGFb3 was a gift from Timothy Springer (Addgene plasmid # 180262 ; http://n2t.net/addgene:180262 ; RRID:Addgene_180262)
  • For your References section:

    Loss of LRRC33-dependent TGFbeta1 activation enhances anti-tumor immunity and checkpoint blockade therapy. Jiang A, Qin Y, Springer TA. Cancer Immunol Res. 2022 Feb 18. pii: 681626. doi: 10.1158/2326-6066.CIR-21-0593. 10.1158/2326-6066.CIR-21-0593 PubMed 35181792