Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLNC Wnt-3aHA
(Plasmid #18030)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 18030 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLNC
  • Backbone size w/o insert (bp) 6620
  • Vector type
    Retroviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH5a, HB101
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Wnt-3a
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1300
  • Entrez Gene
    Wnt3a (a.k.a. Wnt-3a, vt)
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATCG
  • 3′ sequencing primer ACCTACAGGTGGGGTCTTTCATTCCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Gavin, B.J., McMahon, J.A., and McMahon, A.P. Expression of multiple novel Wnt-1/Int-1-related genes during fetal and adult mouse development. Genes Dev.,4:2319-2332, 1990.

Roelink, H., and Nusse, R. Expression of two members of the Wnt family during mouse development -restricted temporal and spatial patterns in the developing neural tube. Genes Dev., 5: 381-388, 1991.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLNC Wnt-3aHA was a gift from Jan Kitajewski (Addgene plasmid # 18030 ; http://n2t.net/addgene:18030 ; RRID:Addgene_18030)
  • For your References section:

    Transformation by Wnt family proteins correlates with regulation of beta-catenin. Shimizu H, Julius MA, Giarre M, Zheng Z, Brown AM, Kitajewski J. Cell Growth Differ. 1997 Dec . 8(12):1349-58. PubMed 9419423